Difference between revisions of "DNA sequencing"

Jump to navigation Jump to search
1,271 bytes added ,  6 months ago
→‎Overview: Fix link
(Also useful for determining the range of a species)
(→‎Overview: Fix link)
(8 intermediate revisions by the same user not shown)
== Overview ==
 
DNA barcoding enables the identification of unknown organisms, discovery of new species, the determination of which features delineate species, accurate determination of the range of a species and the building of phylogenetic trees which show how various organisms are related.
 
Step by step photos of the whole process are available here: https://www.facebook.com/groups/FungalSequencing/permalink/2268745516680176/
 
How to upload DNA sequences to Genbank: https://www.facebook.com/groups/FungalSequencing/permalink/2163215977233131/
 
Jerry Cooper's excellent Notes on home-based PCR for barcoding fungi: https://www.funnz.org.nz/sites/default/files/DIY%20DNA%20PCR_2.pdf
 
== DNA Extraction ==
Papers on the NaOH extraction:
 
A rapid and cheap protocol for preparation of PCR templates in peanut http://www.bioline.org.br/pdf?ej09016
[[File:Wang_etal_NaOH.pdf|link=Special:FilePath/Wang_etal_NaOH.pdf]]
 
Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples https://nature.berkeley.edu/garbelotto/downloads/naohextraction2013.pdf
[[File:Osmundson et al. - 2013 - Back to basics an evaluation of NaOH and alternat.pdf|link=Special:FilePath/Osmundson_et_al._-_2013_-_Back_to_basics_an_evaluation_of_NaOH_and_alternat.pdf]]
 
== Polymerase Chain Reaction (PCR) ==
[https://www.neb.com/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-with-taq-dna-polymerase PCR optimization guidelines]
 
[http://tmcalculator.neb.com AnnealingPrimer annealing temperature calculator]
 
[https://www2.clarku.edu/faculty/dhibbett/Protocols_Folder/Primers/Primers.pdf Primer maps and sequences] ( for loci ITS, LSU, SSU, TEF1, RPB1, RPB2, COX3, ATP6 )
 
 
I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the Taq Keengreen 2x Master Mix [https://www.the-odinibisci.com/products/ibi-taq-polymerase-master-mixkeengreen-2x-1ml-40master-reactions/mix?_pos=1&_sid=46411e7d6&_ss=r<nowiki>], TAQwhich masteralready mixhas availableloading atdye The Odin]included.</nowiki>
 
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees.
 
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]
 
I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the [https://www.the-odin.com/taq-polymerase-master-mix-2x-1ml-40-reactions/ TAQ master mix available at The Odin].
 
When I get primers they are dry, and on the tube it says how much primer is there. I dilute with PCR water or TE buffer to 100 micromolar concentration, and then make aliquots to use that are 5 or 10 micromolar.
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees.
 
I order primers from IDT, and it often says something like "Yield 26.3" - In that case I would add 263 microliters of water to make the 100 micromolar stock solutions. Then in a smaller tube I would add 180 or 190 microliters of water and 10 or 20 microliters of the primer stock solution to make a working primer solution. I add 1 microliter of each primer to a PCR reaction.
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]
 
I store the 10 micromolar stock solutions in the fridge, they are good for a few months at least, and the 100 micromolar stock solution in the freezer - the colder the better. Primers are most stable when dry so it's best to wait until you need to use them to add water - however they are pretty stable in aqueous solution too, as long as the water is very pure (PCR grade is best).
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]
 
 
<!-- [[File:pcrmath.jpg|thumb|alt=PCR math example | PCR math example]]
 
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]
Thumbnails seem to be broken... -->
 
==Gel Electrophoresis==
[https://en.wikipedia.org/wiki/Agarose_gel_electrophoresis Agarose gel electrophoresis]
 
1% [https://en.wikipedia.org/wiki/Agarose agarose], 17.5 uL [https://en.wikipedia.org/wiki/Ethidium_bromide Ethidium Bromide] or [https://en.wikipedia.org/wiki/GelRed GelRed] solution per gel, 75 mL 1x [https://en.wikipedia.org/wiki/TAE_buffer TAE buffer].
 
To make a gel, add agarose to room temperature 1x LAB or TAE buffer, then heat in the microwave to dissolve it into solution. It is important to make it completely clear - no grains of agarose should be visible when you swirl the beaker in front of a light. This often involves a couple minutes of boiling with the microwave - run the microwave until it boils, stop it before it boils over, swirl and run it again every few seconds for a couple minutes. Be careful not to fill the beaker too full or it can get superheated and boil over, possibly burning your hand. Once the gel is completely dissolved, add 3 uL Ethidium Bromide solution per 75 mL gel.
Run the gel at 100 volts DC for 20 minutes. If you leave it for 30 minutes or longer, you will lose your results. Higher voltages work more quickly but give bands that are less sharp.
 
Visualize the gel using a blue light - 490 nanometer wavelength is ideal.
Visualize the gel using a [http://www.instructables.com/id/UV-Transilluminator UV transilluminator]. Do not look at the UV light for more than a half second - you can use a sheet of glass to stop most of the UV and make it safer to view. Yellow safety goggles can be used to filter out the blue, making the results easier to see and providing additional UV eye protection. It is best to quickly photograph your gel and record your results from the photo to save your eyes and prevent sunburn.
 
If you get a strong or medium-strong clear band, it is very likely that you will get a clean sequence from the sample. If you get a weak band, smear or no band at all, [https://en.wikipedia.org/wiki/Nested_polymerase_chain_reaction nested PCR] can be used to further amplify the DNA.
* Align your sequence using your favorite [https://en.wikipedia.org/wiki/Sequence_alignment sequence alignment] program.
* Use the FASTA file to build a phylogenetic tree using [http://www.megasoftware.net Mega 7] for Windows, [http://ugene.net uGene] for Linux or the more difficult but powerful multiplatform command line tool [http://sco.h-its.org/exelixis/web/software/raxml/index.html RaxML] and the java program [http://tree.bio.ed.ac.uk/software/figtree FigTree] to visualize the tree. The easiest way to make a tree is to use the one-click mode at [http://phylogeny.lirmm.fr http://phylogeny.lirmm.fr] - this website allows you to upload a FASTA file, aligns the sequences and makes a tree using the [https://en.wikipedia.org/wiki/Maximum_likelihood Maximum Likelihood] algorithm.
*For more professional phylogenetic trees, use RaxML or MrBayes to generate the tree, then visualize it with Figtree.
 
[http://asserttrue.blogspot.com/2014/05/how-to-build-your-own-phylo-trees-with.html How to use Mega on Windows to make phylogenetic trees]
Cookies help us deliver our services. By using our services, you agree to our use of cookies.

Navigation menu