DNA sequencing: Difference between revisions
Added information on diluting primers
(Updated PCR master mix, electrophoresis, etc.) |
(Added information on diluting primers) |
||
Line 48:
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]
When I get primers they are dry, and on the tube it says how much primer is there. I dilute with PCR water or TE buffer to 100 micromolar concentration, and then make aliquots to use that are 5 or 10 micromolar.
I order primers from IDT, and it often says something like "Yield 26.3" - In that case I would add 263 microliters of water to make the 100 micromolar stock solutions. Then in a smaller tube I would add 180 or 190 microliters of water and 10 or 20 microliters of the primer stock solution to make a working primer solution. I add 1 microliter of each primer to a PCR reaction.
I store the 10 micromolar stock solutions in the fridge, they are good for a few months at least, and the 100 micromolar stock solution in the freezer - the colder the better.
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]
| |||