DNA sequencing: Difference between revisions
PCR water recommendations
(Added primer maps and sequences) |
(PCR water recommendations) |
||
Line 38:
[https://www.neb.com/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-with-taq-dna-polymerase PCR optimization guidelines]
[http://tmcalculator.neb.com
[https://www2.clarku.edu/faculty/dhibbett/Protocols_Folder/Primers/Primers.pdf Primer maps and sequences] ( for loci ITS, LSU, SSU, TEF1, RPB1, RPB2, COX3, ATP6 )
Line 47:
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees.
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]
| |||