DNA sequencing: Difference between revisions
Content added Content deleted
(PCR water recommendations) |
(Updated PCR master mix, electrophoresis, etc.) |
||
Line 1: | Line 1: | ||
== Overview == |
== Overview == |
||
DNA barcoding enables the discovery of new species, the determination of which features delineate species, accurate determination of the range of a species and the building of phylogenetic trees which show how various organisms are related. |
DNA barcoding enables the identification of unknown organisms, discovery of new species, the determination of which features delineate species, accurate determination of the range of a species and the building of phylogenetic trees which show how various organisms are related. |
||
Step by step photos of the whole process are available here: https://www.facebook.com/groups/FungalSequencing/permalink/2268745516680176/ |
Step by step photos of the whole process are available here: https://www.facebook.com/groups/FungalSequencing/permalink/2268745516680176/ |
||
Line 43: | Line 43: | ||
I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the [https://www. |
I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the Taq Keengreen 2x Master Mix [https://www.ibisci.com/products/ibi-taq-keengreen-2x-master-mix?_pos=1&_sid=46411e7d6&_ss=r<nowiki>], which already has loading dye included.</nowiki> |
||
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees. |
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees. |
||
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley] |
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley] |
||
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example] |
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example] |
||
<!-- [[File:pcrmath.jpg|thumb|alt=PCR math example | PCR math example]] |
|||
Thumbnails seem to be broken... --> |
|||
==Gel Electrophoresis== |
==Gel Electrophoresis== |
||
Line 60: | Line 55: | ||
[https://en.wikipedia.org/wiki/Agarose_gel_electrophoresis Agarose gel electrophoresis] |
[https://en.wikipedia.org/wiki/Agarose_gel_electrophoresis Agarose gel electrophoresis] |
||
1% [https://en.wikipedia.org/wiki/Agarose agarose], |
1% [https://en.wikipedia.org/wiki/Agarose agarose], 7.5 uL or [https://en.wikipedia.org/wiki/GelRed GelRed] solution per gel, 75 mL 1x [https://en.wikipedia.org/wiki/TAE_buffer TAE buffer]. |
||
To make a gel, add agarose to room temperature 1x LAB or TAE buffer, then heat in the microwave to dissolve it into solution. It is important to make it completely clear - no grains of agarose should be visible when you swirl the beaker in front of a light. This often involves a couple minutes of boiling with the microwave - run the microwave until it boils, stop it before it boils over, swirl and run it again every few seconds for a couple minutes. Be careful not to fill the beaker too full or it can get superheated and boil over, possibly burning your hand. Once the gel is completely dissolved, add 3 uL Ethidium Bromide solution per 75 mL gel. |
To make a gel, add agarose to room temperature 1x LAB or TAE buffer, then heat in the microwave to dissolve it into solution. It is important to make it completely clear - no grains of agarose should be visible when you swirl the beaker in front of a light. This often involves a couple minutes of boiling with the microwave - run the microwave until it boils, stop it before it boils over, swirl and run it again every few seconds for a couple minutes. Be careful not to fill the beaker too full or it can get superheated and boil over, possibly burning your hand. Once the gel is completely dissolved, add 3 uL Ethidium Bromide solution per 75 mL gel. |
||
Line 70: | Line 65: | ||
Run the gel at 100 volts DC for 20 minutes. If you leave it for 30 minutes or longer, you will lose your results. Higher voltages work more quickly but give bands that are less sharp. |
Run the gel at 100 volts DC for 20 minutes. If you leave it for 30 minutes or longer, you will lose your results. Higher voltages work more quickly but give bands that are less sharp. |
||
Visualize the gel using a blue light - 490 nanometer wavelength is ideal. |
|||
Visualize the gel using a [http://www.instructables.com/id/UV-Transilluminator UV transilluminator]. Do not look at the UV light for more than a half second - you can use a sheet of glass to stop most of the UV and make it safer to view. Yellow safety goggles can be used to filter out the blue, making the results easier to see and providing additional UV eye protection. It is best to quickly photograph your gel and record your results from the photo to save your eyes and prevent sunburn. |
|||
If you get a strong or medium-strong clear band, it is very likely that you will get a clean sequence from the sample. If you get a weak band, smear or no band at all, [https://en.wikipedia.org/wiki/Nested_polymerase_chain_reaction nested PCR] can be used to further amplify the DNA. |
If you get a strong or medium-strong clear band, it is very likely that you will get a clean sequence from the sample. If you get a weak band, smear or no band at all, [https://en.wikipedia.org/wiki/Nested_polymerase_chain_reaction nested PCR] can be used to further amplify the DNA. |