DNA sequencing: Difference between revisions
Updated information on the PCR master mix I use and where to get it |
→Sequencing: Added a Mclab DNA sequencing ordering template |
||
(34 intermediate revisions by 4 users not shown) | |||
Line 1:
== Overview ==
DNA barcoding enables the identification of unknown organisms, discovery of new species, the determination of which features delineate species, accurate determination of the range of a species and the building of phylogenetic trees which show how various organisms are related. The most powerful thing that DNA barcoding does is it tells you which collections are the same species. If your goal is to get insights into strains of the same species or learn which genes are present, you'll need to use a different process called full genome sequencing.
Step by step photos of the whole process are available here: https://www.facebook.com/groups/FungalSequencing/permalink/2268745516680176/
A video which shows the whole DNA barcoding process is here: https://www.facebook.com/groups/FungalSequencing/permalink/2276807085874019/
YouTube playlist with DNA barcoding videos: https://www.youtube.com/playlist?list=PLi7dEmBMB3xvyt1OY7l18BXR1VpLZcLsP
Sigrid's PCR protocol: https://docs.google.com/document/d/13B9OSE_ar_vWWZnHZegr2FROnMak78qHZxEZXc1E9jk
How to upload DNA sequences to Genbank: https://www.facebook.com/groups/FungalSequencing/permalink/2163215977233131/
Jerry Cooper's excellent Notes on home-based PCR for barcoding fungi: https://www.funnz.org.nz/sites/default/files/DIY%20DNA%20PCR_2.pdf
Nanopore DNA sequencing protocol by Stephen Russell: https://www.protocols.io/view/ont-dna-barcoding-fungal-amplicons-w-minion-amp-fl-36wgq7qykvk5/v2/protocols
If you would like to send in a mushroom and pay about $25 to have it barcoded, you can send to to http://alvalab.es in Spain.
You can also send mushrooms to the Ohio Mushroom DNA Lab for sequencing. They accept donations but do not charge a fee. https://docs.google.com/document/d/1nSKlouFy1Z3OXbCf2cWiKH0hkDnFKZvPn6_oCr3vEK0/edit
== DNA Extraction ==
Line 13 ⟶ 25:
The goal of DNA extraction is to get a few nanograms of your organism's DNA into solution so it can be used as a [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR template].
Two good DNA extraction methods are the NaOH extraction and [http://www.sigmaaldrich.com/life-science/molecular-biology/dna-and-rna-purification/extract-n-amp.html ExtractNAmp]. In a pinch you can just use water.
* NaOH extraction (Wang et al. 1993, Osmundson et al. 2013). 200 μL of 0.5 M NaOH is added to the ground tissue. 5 μL of the extract is diluted in 495 μL of 100 mM Tris-HCl, pH 8.0 (pH is adjusted with pH meter and HCl until it is 8.0), and 1 μL of the dilution is used as template DNA for a 25 μL PCR reaction.
Line 21 ⟶ 33:
[[http://i.imgur.com/9fLgFqJ.jpg|thumb|left|alt=NaOH DNA Extraction]]
Another good way to extract DNA is with IBI X-Amp. PCR success is as good or better than the other methods, and there's not as much that can be messed up since you don't need to mix any chemicals. https://www.ibisci.com/products/x-amp-dna-reagent
The amount of mushroom you use is not critical, but smaller pieces often have a higher chance of working since there is less likelihood of contamination. I usually use about 20 milligrams, and if it is a tiny collection and I want to use less I use less DNA extraction solution. Since only 1 uL is needed for the template DNA, in theory you can get a good sequence from a piece of mushroom that is nearly too small to see. If the mushroom has gills, use that part because they have more DNA. If the mushroom is thick, break it in half and use part of the inside of the cap to reduce the chance of contamination. Get the mushroom piece with forceps and heat sterilize them between samples to reduce cross contamination.▼
▲The amount of mushroom you use is not critical, but smaller pieces often have a higher chance of working since there is less likelihood of contamination, and smaller pieces of mushroom allow you to use less DNA extraction reagent. I usually use about 20 milligrams, and if it is a tiny collection and I want to use less I use less DNA extraction solution. Since only 1 uL is needed for the template DNA, in theory you can get a good sequence from a piece of mushroom that is nearly too small to see. If the mushroom has gills, use that part because they have more DNA. If the mushroom is thick, break it in half and use part of the inside of the cap to reduce the chance of contamination. Get the mushroom piece with forceps and heat sterilize them between samples to reduce cross contamination. Flat tipped forceps may not need heat sterilization, you can just wipe them off. Sometimes I grind the samples with plastic pestles after adding extraction solution, but this isn't necessary and I am not sure if it helps. Grinding the samples probably increases the chance of success with something hard like a polypore but decreases the chance of success if your sample includes PCR inhibitors.
I suggest doing DNA extractions in .2 ml PCR tubes - that way you can incubate the DNA extractions in your thermocycler, and they are easier to store in the freezer. It is best to save DNA extractions so you can rerun PCR later with different primers to sequence additional genes.
PCR works at a wide range of DNA concentrations, and a likely cause of PCR failure is the presence of PCR inhibitors. More lengthy DNA extraction protocols can separate the DNA from PCR inhibitors. This is more often required with samples that have a lot of pigments.
Line 30 ⟶ 45:
Papers on the NaOH extraction:
A rapid and cheap protocol for preparation of PCR templates in peanut http://www.bioline.org.br/pdf?ej09016
Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples https://nature.berkeley.edu/garbelotto/downloads/naohextraction2013.pdf
In a pinch, plain water can be used as DNA extraction solution.
== Polymerase Chain Reaction (PCR) ==
Line 38 ⟶ 55:
[https://www.neb.com/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-with-taq-dna-polymerase PCR optimization guidelines]
[http://tmcalculator.neb.com
[https://www2.clarku.edu/faculty/dhibbett/Protocols_Folder/Primers/Primers.pdf Primer maps and sequences] ( for loci ITS, LSU, SSU, TEF1, RPB1, RPB2, COX3, ATP6 )
I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the [https://www.the-odin.com/taq-polymerase-master-mix-2x-1ml-40-reactions/ TAQ master mix available at The Odin].▼
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees. ▼
▲I use a 25 μL [https://en.wikipedia.org/wiki/Polymerase_chain_reaction PCR] reaction which includes 1 μL of 10 μM forward [https://en.wikipedia.org/wiki/Primer_(molecular_biology) primer], 1 μL of 10 μM reverse primer, 1 μL DNA template and the [https://www.google.com/search?q=pcr+master+mix&oq=PCR+master+mix PCR master mix]. I use the Taq Meangreen 2x Master Mix [https://
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]▼
▲The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the [http://biotools.nubic.northwestern.edu/OligoCalc.html melting point] of the primers and subtracting 3 - 5 degrees.
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]▼
▲I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. [https://sites.google.com/site/mpnelsen/primer-maps Primer maps] [https://nature.berkeley.edu/brunslab/tour/primers.html Primer sequences from UC Berkeley]
When I get primers they are dry, and on the tube it says how much primer is there. I dilute with PCR water or TE buffer to 100 micromolar concentration, and then make aliquots to use that are 5 or 10 micromolar.
I order primers from IDT, and it often says something like "Yield 26.3" - In that case I would add 263 microliters of water to make the 100 micromolar stock solutions. Then in a smaller tube I would add 180 or 190 microliters of water and 10 or 20 microliters of the primer stock solution to make a working primer solution. I add 1 microliter of each primer to a PCR reaction.
I store the 10 micromolar stock solutions in the fridge, they are good for a few months at least, and the 100 micromolar stock solution in the freezer - the colder the better. Primers are most stable when dry so it's best to wait until you need to use them to add water - however they are pretty stable in aqueous solution too, as long as the water is very pure (PCR grade is best).
▲PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. [https://counterculturelabs.org/wiki/images/d/d7/Pcrmath.jpg PCR math example]
==Gel Electrophoresis==
Electrophoresis can tell you if your PCR worked. You can skip this step if you want to save time - you will spend a little more on sequencing PCR reactions that did not work.
[https://en.wikipedia.org/wiki/Agarose_gel_electrophoresis Agarose gel electrophoresis]
1% [https://en.wikipedia.org/wiki/Agarose agarose],
To make a gel, add agarose to room temperature 1x LAB or TAE buffer, then heat in the microwave to dissolve it into solution. It is important to make it completely clear - no grains of agarose should be visible when you swirl the beaker in front of a light. This often involves a couple minutes of boiling with the microwave - run the microwave until it boils, stop it before it boils over, swirl and run it again every few seconds for a couple minutes. Be careful not to fill the beaker too full or it can get superheated and boil over, possibly burning your hand. Once the gel is completely dissolved, add 3 uL Ethidium Bromide solution per 75 mL gel.
Line 67 ⟶ 95:
Run the gel at 100 volts DC for 20 minutes. If you leave it for 30 minutes or longer, you will lose your results. Higher voltages work more quickly but give bands that are less sharp.
Visualize the gel using a blue light - 490 nanometer wavelength is ideal.
If you get a strong or medium-strong clear band, it is very likely that you will get a clean sequence from the sample. If you get a weak band, smear or no band at all, [https://en.wikipedia.org/wiki/Nested_polymerase_chain_reaction nested PCR] can be used to further amplify the DNA.
Line 79 ⟶ 107:
If the gel electrophoresis indicates that the PCR reaction worked, it can be brought in for sequencing. For sequencing I use [http://www.genewiz.com/ Genewiz], which will pick up samples directly from CCL. If you fill out the sequencing order by 3:30pm, the courier arrives around five and you will get the sequences at about 6am the next morning. If you sign up for a new account, the first two sequences are free. If you have Genewiz do the DNA quantification and PCR cleanup, they charge $7 per sample or $5 per sample if you do 96 at a time.
[
Lower cost sequencing options are available, though you need to mail in the PCR products rather than having them picked up if you aren't near the lab. Two low cost Sanger sequencing options are [https://www.eurofinsgenomics.com/en/products/dna-sequencing/all-sequencing-options/ Eurofins] and [http://www.mclab.com/DNA-Sequencing-Services.html McLab]. Mclab is the least expensive, at $5 per sample for a bidirectional read with PCR cleanup (if you order 8 reactions at a time), which is less than half of what Genewiz charges. Often the forward works and the reverse doesn't, or vice versa - usually one of them works unless you have multiple templates being amplified or some other problem. Mclab can be a little tricky to order from because they want you to fill out an Excel order form - it's not difficult if you have a template to work from, available [https://images.mushroomobserver.org/Mclab%20DNA%20barcoding%20sample%20form.xlsx here.]
Another way to sequence PCR products is with a MinION DNA sequencer. This method is much newer than Sanger and has much higher startup cost, but once it is running it is a whole lot faster and less expensive than Sanger sequencing - with similar quality data. For more information on how to do this, see https://www.protocols.io/view/ont-dna-barcoding-fungal-amplicons-w-minion-amp-fl-36wgq7qykvk5/v2/protocols.
Line 96 ⟶ 129:
* Align your sequence using your favorite [https://en.wikipedia.org/wiki/Sequence_alignment sequence alignment] program.
* Use the FASTA file to build a phylogenetic tree using [http://www.megasoftware.net Mega 7] for Windows, [http://ugene.net uGene] for Linux or the more difficult but powerful multiplatform command line tool [http://sco.h-its.org/exelixis/web/software/raxml/index.html RaxML] and the java program [http://tree.bio.ed.ac.uk/software/figtree FigTree] to visualize the tree. The easiest way to make a tree is to use the one-click mode at [http://phylogeny.lirmm.fr http://phylogeny.lirmm.fr] - this website allows you to upload a FASTA file, aligns the sequences and makes a tree using the [https://en.wikipedia.org/wiki/Maximum_likelihood Maximum Likelihood] algorithm.
*For more professional phylogenetic trees, use RaxML or MrBayes to generate the tree, then visualize it with Figtree.
* Seqtrace is a free program developed by Google which can generate a consensus sequence from forward and reverse chromatograms.
[http://asserttrue.blogspot.com/2014/05/how-to-build-your-own-phylo-trees-with.html How to use Mega on Windows to make phylogenetic trees]
Line 101 ⟶ 136:
==Supplies Needed==
* PCR machine [https://www.ebay.com/sch/i.html?_nkw=PCR+machine $349] (avoid the cheap Thermo Hybaid brand, Josiah says these break really easily. Good ones are Biorad, MJ Research
* Gel box with tray and comb [https://www.ebay.com/sch/i.html?_nkw=Gel+Electrophoresis about $100] or [http://citizensciencequarterly.com/2011/10/cheapass-science-gel-box/ make your own for $21]▼
▲* PCR machine [https://www.ebay.com/sch/i.html?_nkw=PCR+machine $349] (avoid the cheap Thermo Hybaid brand, Josiah says these break really easily. Good ones are MJ Research (usually about $400) and Applied Biosystems (reliable and cheap, like $100, but huge - shipping is like $75)
* 10 uL and 200 uL pipettes [http://www.ebay.com/itm/NEW-Oxford-10-50uL-Adjustable-Micro-Pipette-Series-3000-Sampler-System-Pipet-/291224844297?hash=item43ce5a7809:g:lQIAAOSwxCxT96LG 10 - 50 uL $20] [http://www.ebay.com/itm/Brand-New-Single-Channel-Adjustable-Pipetman-20-200uL-p200-pipet-Pipette-j2e-/182032059910?hash=item2a61f4ce06:g:40QAAOSwiylW~eU2 P200 $22]
* PCR master mix [https://www.the-odin.com/taq-polymerase-master-mix-2x-1ml-40-reactions/ $30 for 40 reactions] [https://empiricalbioscience.com/shop/rae/grouping-2-rae/taq-2x-colorless-mastermix-4/ $88 for 500 reactions]
* Electrophoresis DC power supply [https://www.ebay.com/sch/i.html?_nkw=Electrophoresis+power+supply $50]▼
* Pipette tips (sterile, for p10 and p200 pipettes) $40
* PCR tubes [http://www.ebay.com/itm/Azzota-PCR-Tubes-Flat-8-strip-Caps-120pcs-pk-/252184303378?hash=item3ab75b1712:g:9DUAAOSwt6ZWVJCA $10 for 120 tubes]
* DNA extraction supplies (or IBI X-Amp) (NaOH and TRIS buffer, optionally plastic pestles. If you get pestles get the size for the .5 ml tubes so you can use 200 uL PCR tubes for DNA extractions) [https://www.ebay.com/sch/i.html?_nkw=Sodium+Hydroxide $10] [https://www.ebay.com/sch/i.html?_nkw=TRIS+base $10]
* Ethidium Bromide or other DNA stain [http://www.the-odin.com/gel-green-like-dna-stain-for-gels-10-000x-100ul/ $10]▼
*
* Agarose [http://www.the-odin.com/agarose/ $10]▼
* Gel loading dye [http://www.the-odin.com/6x-dual-color-dna-loading-dye/ $5]▼
* TAE buffer concentrate [http://www.the-odin.com/tae-buffer-mix-10-l-50g/ $10]
* Tube rack for DNA extracts [http://www.the-odin.com/microcentrifuge-tube-rack-60-tube-2-sided-1-5-ml-and-0-5-or-0-2-ml-reversible/ $5]
* Pure, DNA-free water $2 (bottled distilled water works)
▲* Gel box with tray and comb [https://www.ebay.com/sch/i.html?_nkw=Gel+Electrophoresis about $100] or [
▲* Electrophoresis DC power supply [https://www.ebay.com/sch/i.html?_nkw=Electrophoresis+power+supply $50] (optional)
▲*
* 100 bp DNA Marker (optional) [http://www.the-odin.com/dna-ladder-100bp/ $10]
▲* Gel loading dye (not necessary if you get master mix that already has loading dye) [http://www.the-odin.com/6x-dual-color-dna-loading-dye/ $5] (optional)
* Blue LED light (490 nanometer) and orange glasses for viewing DNA on gel (a 365 nanometer UV flashlight works even better - no orange glasses needed) [https://www.amazon.com/dp/B005IPPBNI $17] (optional)
▲* Agarose [http://www.the-odin.com/agarose/ $10] (optional)
* Total cost: $895 (or about $200 less if you DIY some of the pieces)
== Location of equipment in CCL ==
|
Latest revision as of 09:04, 1 August 2024
Overview[edit | edit source]
DNA barcoding enables the identification of unknown organisms, discovery of new species, the determination of which features delineate species, accurate determination of the range of a species and the building of phylogenetic trees which show how various organisms are related. The most powerful thing that DNA barcoding does is it tells you which collections are the same species. If your goal is to get insights into strains of the same species or learn which genes are present, you'll need to use a different process called full genome sequencing.
Step by step photos of the whole process are available here: https://www.facebook.com/groups/FungalSequencing/permalink/2268745516680176/
A video which shows the whole DNA barcoding process is here: https://www.facebook.com/groups/FungalSequencing/permalink/2276807085874019/
YouTube playlist with DNA barcoding videos: https://www.youtube.com/playlist?list=PLi7dEmBMB3xvyt1OY7l18BXR1VpLZcLsP
Sigrid's PCR protocol: https://docs.google.com/document/d/13B9OSE_ar_vWWZnHZegr2FROnMak78qHZxEZXc1E9jk
How to upload DNA sequences to Genbank: https://www.facebook.com/groups/FungalSequencing/permalink/2163215977233131/
Jerry Cooper's excellent Notes on home-based PCR for barcoding fungi: https://www.funnz.org.nz/sites/default/files/DIY%20DNA%20PCR_2.pdf
Nanopore DNA sequencing protocol by Stephen Russell: https://www.protocols.io/view/ont-dna-barcoding-fungal-amplicons-w-minion-amp-fl-36wgq7qykvk5/v2/protocols
If you would like to send in a mushroom and pay about $25 to have it barcoded, you can send to to http://alvalab.es in Spain.
You can also send mushrooms to the Ohio Mushroom DNA Lab for sequencing. They accept donations but do not charge a fee. https://docs.google.com/document/d/1nSKlouFy1Z3OXbCf2cWiKH0hkDnFKZvPn6_oCr3vEK0/edit
DNA Extraction[edit | edit source]
The goal of DNA extraction is to get a few nanograms of your organism's DNA into solution so it can be used as a PCR template.
Two good DNA extraction methods are the NaOH extraction and ExtractNAmp. In a pinch you can just use water.
- NaOH extraction (Wang et al. 1993, Osmundson et al. 2013). 200 μL of 0.5 M NaOH is added to the ground tissue. 5 μL of the extract is diluted in 495 μL of 100 mM Tris-HCl, pH 8.0 (pH is adjusted with pH meter and HCl until it is 8.0), and 1 μL of the dilution is used as template DNA for a 25 μL PCR reaction.
- More purified DNA can be made with this protocol.
Another good way to extract DNA is with IBI X-Amp. PCR success is as good or better than the other methods, and there's not as much that can be messed up since you don't need to mix any chemicals. https://www.ibisci.com/products/x-amp-dna-reagent
The amount of mushroom you use is not critical, but smaller pieces often have a higher chance of working since there is less likelihood of contamination, and smaller pieces of mushroom allow you to use less DNA extraction reagent. I usually use about 20 milligrams, and if it is a tiny collection and I want to use less I use less DNA extraction solution. Since only 1 uL is needed for the template DNA, in theory you can get a good sequence from a piece of mushroom that is nearly too small to see. If the mushroom has gills, use that part because they have more DNA. If the mushroom is thick, break it in half and use part of the inside of the cap to reduce the chance of contamination. Get the mushroom piece with forceps and heat sterilize them between samples to reduce cross contamination. Flat tipped forceps may not need heat sterilization, you can just wipe them off. Sometimes I grind the samples with plastic pestles after adding extraction solution, but this isn't necessary and I am not sure if it helps. Grinding the samples probably increases the chance of success with something hard like a polypore but decreases the chance of success if your sample includes PCR inhibitors.
I suggest doing DNA extractions in .2 ml PCR tubes - that way you can incubate the DNA extractions in your thermocycler, and they are easier to store in the freezer. It is best to save DNA extractions so you can rerun PCR later with different primers to sequence additional genes.
PCR works at a wide range of DNA concentrations, and a likely cause of PCR failure is the presence of PCR inhibitors. More lengthy DNA extraction protocols can separate the DNA from PCR inhibitors. This is more often required with samples that have a lot of pigments.
Papers on the NaOH extraction:
A rapid and cheap protocol for preparation of PCR templates in peanut http://www.bioline.org.br/pdf?ej09016
Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples https://nature.berkeley.edu/garbelotto/downloads/naohextraction2013.pdf
In a pinch, plain water can be used as DNA extraction solution.
Polymerase Chain Reaction (PCR)[edit | edit source]
Primer annealing temperature calculator
Primer maps and sequences ( for loci ITS, LSU, SSU, TEF1, RPB1, RPB2, COX3, ATP6 )
I use a 25 μL PCR reaction which includes 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL DNA template and the PCR master mix. I use the Taq Meangreen 2x Master Mix [https://empiricalbioscience.com/shop/rae/grouping-3-rae/taq-2x-meangreen-master-mix-copy-2/], which already has loading dye included.
The current PCR program I am using is an initial denaturation of two minutes at 95 degrees C, followed by 30 cycles of denaturation at 95 degrees for 30 seconds, annealing at 54 degrees for 30 seconds and an extension phase of 72 degrees for 55 seconds. Since the DNA we are amplifying typically isn't very long, it is probably ok to omit the final extension phase of 6 minutes at 70 degrees. The 54 degree annealing temperature was chosen by looking up the melting point of the primers and subtracting 3 - 5 degrees.
I usually use the fungal specific forward primer its1-f (CTTGGTCATTTAGAGGAAGTAA). For basidiomycetes I use the basidiomycete specific primer its4-b (CAGGAGACTTGTACACGGTCCAG) and for ascomycetes the less specific reverse primer its4 (TCCTCCGCTTATTGATATGC). Longer sequences can be made by using the TW13 reverse primer (1200 bases) or LR3 reverse primer (1500 bases). The longer sequences get ITS1, ITS2 and the beginning of LSU. Good LSU primers are LR0R/LR7 (1400 bases) or LR3R/LR7 (the most important part of the LSU, 750 bases). TAQ polymerase copies about 1000 bases per minute, so adjust the extension time on the PCR program accordingly. Various LSU, RPB1, RPB2 and EF1-a and various plant primers are also in the CCL freezer. Primer maps Primer sequences from UC Berkeley
When I get primers they are dry, and on the tube it says how much primer is there. I dilute with PCR water or TE buffer to 100 micromolar concentration, and then make aliquots to use that are 5 or 10 micromolar.
I order primers from IDT, and it often says something like "Yield 26.3" - In that case I would add 263 microliters of water to make the 100 micromolar stock solutions. Then in a smaller tube I would add 180 or 190 microliters of water and 10 or 20 microliters of the primer stock solution to make a working primer solution. I add 1 microliter of each primer to a PCR reaction.
I store the 10 micromolar stock solutions in the fridge, they are good for a few months at least, and the 100 micromolar stock solution in the freezer - the colder the better. Primers are most stable when dry so it's best to wait until you need to use them to add water - however they are pretty stable in aqueous solution too, as long as the water is very pure (PCR grade is best).
PCR math: Add 10% to however many samples you want to run to ensure that you have enough PCR mix for all of your tubes. Multiply the number of samples by 25, assuming that you are doing a 25 uL PCR reaction. This number is your total PCR mix volume. Divide the total volume by 5 to see how much PCR master mix to add, assuming that you are using 5x master mix concentrate. Subtract the amount of concentrate, primer and template DNA you will add from the total volume to see how much pure water to add. It's best to use PCR grade water, but in a pinch distilled water works, or bottled spring water. Tap water also works but isn't recommended. PCR math example
Gel Electrophoresis[edit | edit source]
Electrophoresis can tell you if your PCR worked. You can skip this step if you want to save time - you will spend a little more on sequencing PCR reactions that did not work.
1% agarose, 7.5 uL or GelRed solution per gel, 75 mL 1x TAE buffer.
To make a gel, add agarose to room temperature 1x LAB or TAE buffer, then heat in the microwave to dissolve it into solution. It is important to make it completely clear - no grains of agarose should be visible when you swirl the beaker in front of a light. This often involves a couple minutes of boiling with the microwave - run the microwave until it boils, stop it before it boils over, swirl and run it again every few seconds for a couple minutes. Be careful not to fill the beaker too full or it can get superheated and boil over, possibly burning your hand. Once the gel is completely dissolved, add 3 uL Ethidium Bromide solution per 75 mL gel.
To use the gel, put it into a gel box and pour 1x TAE buffer over it until the buffer barely overflows to cover the gel, making sure to fill all the wells as you pour the buffer. Keep in mind that the DNA will move towards the positive electrode, so make sure you orient the gel correctly. Set a small sheet of parafilm in front of the gel box and pipette 3 uL drops of 10x loading buffer for as many wells as you have in your gel. Do this in rows of 8 so it is easy to keep track of which sample is going into each lane. Add 8 uL of your PCR products to the drops on the parafilm and pipette them into the wells on the gel. This process should be done quickly so the drops don't evaporate too much and the DNA does not disperse throughout the gel before you turn on the electricity. You don't need to hurry, but you also shouldn't stop in the middle and go do something else for awhile.
Optionally, you can use one of your lanes for a DNA ladder to verify that the gel is showing DNA correctly and see the size of your PCR product.
Run the gel at 100 volts DC for 20 minutes. If you leave it for 30 minutes or longer, you will lose your results. Higher voltages work more quickly but give bands that are less sharp.
Visualize the gel using a blue light - 490 nanometer wavelength is ideal.
If you get a strong or medium-strong clear band, it is very likely that you will get a clean sequence from the sample. If you get a weak band, smear or no band at all, nested PCR can be used to further amplify the DNA.
TAE buffer is the standard buffer used, but it may not be the best choice - Borax (Sodium borate) can be used instead, allowing higher voltage and therefore faster gels. See Faster even cool DNA gels.
Sequencing[edit | edit source]
If the gel electrophoresis indicates that the PCR reaction worked, it can be brought in for sequencing. For sequencing I use Genewiz, which will pick up samples directly from CCL. If you fill out the sequencing order by 3:30pm, the courier arrives around five and you will get the sequences at about 6am the next morning. If you sign up for a new account, the first two sequences are free. If you have Genewiz do the DNA quantification and PCR cleanup, they charge $7 per sample or $5 per sample if you do 96 at a time.
Genewiz sample submission guidelines
Lower cost sequencing options are available, though you need to mail in the PCR products rather than having them picked up if you aren't near the lab. Two low cost Sanger sequencing options are Eurofins and McLab. Mclab is the least expensive, at $5 per sample for a bidirectional read with PCR cleanup (if you order 8 reactions at a time), which is less than half of what Genewiz charges. Often the forward works and the reverse doesn't, or vice versa - usually one of them works unless you have multiple templates being amplified or some other problem. Mclab can be a little tricky to order from because they want you to fill out an Excel order form - it's not difficult if you have a template to work from, available here.
Another way to sequence PCR products is with a MinION DNA sequencer. This method is much newer than Sanger and has much higher startup cost, but once it is running it is a whole lot faster and less expensive than Sanger sequencing - with similar quality data. For more information on how to do this, see https://www.protocols.io/view/ont-dna-barcoding-fungal-amplicons-w-minion-amp-fl-36wgq7qykvk5/v2/protocols.
[ MClab does DNA sequencing less expensively]
Bioinformatics[edit | edit source]
- Download the sequence and chromatogram from your sequencing facility.
- BLAST the sequence.
- At the base pairs where you see a difference between your sequence and the closest BLAST match, verify on the chromatogram to see if the differences are real or just sequencer errors. Fix any sequencer errors and save the text file. I use the free software FinchTV to view chromatograms, however this program is no longer supported and can be hard to find. There are various other free options.
- BLAST the fixed sequence and download some of the matches in FASTA format. You can make a tree with all close matches, or just select the sequences that you want to compare your sample to.
- Add your sequence to the FASTA file with a text editor.
- Align your sequence using your favorite sequence alignment program.
- Use the FASTA file to build a phylogenetic tree using Mega 7 for Windows, uGene for Linux or the more difficult but powerful multiplatform command line tool RaxML and the java program FigTree to visualize the tree. The easiest way to make a tree is to use the one-click mode at http://phylogeny.lirmm.fr - this website allows you to upload a FASTA file, aligns the sequences and makes a tree using the Maximum Likelihood algorithm.
- For more professional phylogenetic trees, use RaxML or MrBayes to generate the tree, then visualize it with Figtree.
- Seqtrace is a free program developed by Google which can generate a consensus sequence from forward and reverse chromatograms.
How to use Mega on Windows to make phylogenetic trees
Supplies Needed[edit | edit source]
- PCR machine $349 (avoid the cheap Thermo Hybaid brand, Josiah says these break really easily. Good ones are Biorad, MJ Research and Applied Biosystems (reliable and cheap, like $100, but huge - shipping is like $75)
- 10 uL and 200 uL pipettes 10 - 50 uL $20 P200 $22
- PCR master mix $30 for 40 reactions $88 for 500 reactions
- Pipette tips (sterile, for p10 and p200 pipettes) $40
- PCR tubes $10 for 120 tubes
- DNA extraction supplies (or IBI X-Amp) (NaOH and TRIS buffer, optionally plastic pestles. If you get pestles get the size for the .5 ml tubes so you can use 200 uL PCR tubes for DNA extractions) $10 $10
- PCR primers $25
- TAE buffer concentrate $10
- Tube rack for DNA extracts $5
- Pure, DNA-free water $2 (bottled distilled water works)
- Gel box with tray and comb about $100 or make your own for $21 The Thought Emporium on Youtube also has a cheap gel box. (optional)
- Electrophoresis DC power supply $50 (optional)
- DNA stain $10 (optional)
- 100 bp DNA Marker (optional) $10
- Gel loading dye (not necessary if you get master mix that already has loading dye) $5 (optional)
- Blue LED light (490 nanometer) and orange glasses for viewing DNA on gel (a 365 nanometer UV flashlight works even better - no orange glasses needed) $17 (optional)
- Agarose $10 (optional)
- Total cost: $895 (or about $200 less if you DIY some of the pieces)
Location of equipment in CCL[edit | edit source]
- The Bio-Rad PCR machine is in the back locked room.
- There is a 24 well and two 96 well PCR machines near the BioSafety Cabinet.
- Larger stocks of primers and PCR Master Mix are in the -40 freezer. Smaller aliquots of primers and PCR master mix are in the 4 degree fridge.
- Gel Boxes are in the BSL2 room (in the back right of CCL).
- Electrophoresis power supplies are on the lab bench nearest the freezers.
- DNA extraction chemicals, Ethidium Bromide and forceps are in the DNA sequencing cabinet (near the -80 freezer)
- PCR tubes and pestiles and autoclaved tubes are in the drawers near the -80 freezer.
- If you can't find something or have questions on anything, email alanQQQQrockefeller at gmail.com, but remove the QQQQ as that was added to foil spam robots.